Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2341 
Type of strain Targeted mutant. 
Strain name B6;BDF1-pcid2tm1.2LrsnImku 
Internal Code wap-cre-thp1-floxed 
Submitter Kuwahara Kazuhiko 
Submitter affiliation or code Aichi Cancer Center Research Institute 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Aichi Cancer Center Research Institute 
Organization code  
Developer Kazuhiko Kuwahara 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
pcid2 
Gene name PCI domain containing 2 
Allele symbol pcid2tm1.2LrsnImku 
Allele name PCI domain containing 2, targeted mutation1.2, 
MGI MGI:2443003 
Chromosome 8 (5.73) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Cre1  AGGTTCGTTCACTCATGGA 
Sma3'-Cre  CATCGCCATCTTCCAGCAGGCGC 
 
 Primer 2
  PCR Primer Neo2  GCCTGCTTGCCGAATATCATGGTGGAAAAT 
Thp1 cv 3'  GTTCGCATAGCTCTCACATAGGGGTGCTGTGGCC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
cancer