Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes 
 Strain information
  CARD ID
2156 
Type of strain Targeted mutant. 
Strain name STOCK Pate5tm1a(KOMP)Osb/12G 
Internal Code PateA KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Pate5 
Gene name prostate and testis expressed 5 
Allele symbol Pate5tm1a(KOMP)Osb/12G 
Allele name prostate and testis expressed 5; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:3839959 
Chromosome 9 (20.48) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer #5083  ACTGATGGCGAGCTCAGACC 
#5689  CAGTACTGTGTTGCAACTGG 
 
 Primer 2
  PCR Primer #6030  GGGATGTGAACCAAGATGAAAAGTGATGC 
#6031  CTTGGGTACACCTTCCCTGTCACATAG