CARD R-BASE ( Mouse Strain Resource )

Center for Animal Resources and Development Database !

CARD

Home > Strains > Strain detail

Strain Detail

- Strains

- Genes

- Reference

- Disease,Applicable field

Strain information

	CARD ID		2828
	Type of strain		Targeted mutant.
	Strain name		C57BL/6-Mpst^tm2
	Internal Code		C57BL/6J-Mercaptopyruvate sulfurtranferase (targeted mutation 2)
	Submitter		ISHII ISAO
	Submitter affiliation or code		Showa Pharmaceutical University
	Stock Type
	Material Transfer Conditions		Other conditions. Collaboration with Prof. Isao Ishii at Showa Pharmaceutical University. Concession to the third person is prohibited.
	Production method		In-house breading.
	Origin (In-house)	Organization	Showa Pharmaceutical University
		Organization code
		Developer	Isao Ishii
	Origin (From other organizations)	Organization
		Organization code
		Developer
		Year introduced
		Introduced Generation
	Remarks

Gene information

Gene information 1

	Gene symbol		Mpst
	Gene name		Mercaptopyruvate sulfurtransferase
	Allele symbol		Mpst^em2
	Allele name		Mercaptopyruvate sulfurtransferase, endonuclease-mediated mutation 2,
	MGI		MGI:2179733
	Chromosome		15 (E2\|15 , 37.47)
	Gene classification		Targeted or trapped gene(knockout etc.)
	Method		Electroporation
	OMIM

Primer 1

	PCR Primer	Mpst-3n	GCATATAAGGCCAGCACACGG
		Mpst-5n	CCTAGACCGGCTCAATGAATGT

Reference information

reference information 1

	Author	Akahoshi, N., Minakawa, T., Miyashita, M., Sugiyama, U., Saito, C., Takemoto, R., Honda, A., Kamichatani, W., Kamata, S., Anan, Y., Ishii, I.
	Title	Increased Urinary 3-Mercaptolactate Excretion and Enhanced Passive Systemic Anaphylaxis in Mice Lacking Mercaptopyruvate Sulfurtransferase, a Model of Mercaptolactate-Cysteine Disulfiduria.
	Journal	Int J Mol Sci
	Volume	21
	Page	818; doi:10.3390/ijms21030818
	Year	2020 Jan 27
	PMID

Disease , Applicable field information

Disease name,
Applicable field

Metabolism, Behavior