Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2876 
Type of strain Transgenic. 
Strain name B6-Tg(Pax7-YFP) 
Internal Code Pax7-YFP 
Submitter Ono Yusuke  
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization UNITECH 
Organization code  
Developer  
Year introduced October 2015  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gene name Pax7 
Allele symbol  
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer Pax7 YFP forward primer  AGCGCCGTATGAAGCTTGGG 
Pax7 YFP reverse primer  AAGGGGACTGAGGTGAGGAGA 
 

 Reference information
 reference information 1
  Author
Kitajima Yasuo, Ono Yusuke 
Title Visualization of PAX7 protein dynamics in muscle satellite cells in a YFP knock-in-mouse line 
Journal Skelet Muscle 
Volume 8(1):26 
Page  
Year 2018 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Neurobiology, Development, Anatomy, Physiology