Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2066 
Type of strain Targeted mutant. 
Strain name MSM/Ms-Hnf1atm1Card 
Internal Code MSM/Ms-Hnf1atm1Card 
Submitter Yamamura Ken-ichi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code Card 
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Hnf1a 
Gene name HNF1 homeobox A 
Allele symbol Hnf1atm1Card 
Allele name HNF1 homeobox A, targeted mutation 1, Naomi Nakagata 
MGI MGI:98504 
Chromosome 5 (55.99) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer neo_3AR4  AAGATATCATTTCAAAGGCTGGCATGCG 
neo_G02  ATCAGGACATAGCGTTGGCTAC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Diabetes