Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2994 
Type of strain Transgenic. 
Strain name C57BL/6J-Tg(Atp1a2M731T)7000Kwk 
Internal Code Atp1a2M731T7000 
Submitter SUGIMOTO HIROKI 
Submitter affiliation or code Center for Molecular Medicine, Jichi Medical University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Atp1a2 
Gene name ATPase Na+/K+ transporting, alpha 2 polypeptide 
Allele symbol  
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer 731F2  CAGCTGGATGAGATCCTCAG 
731mutR6  AGCCGGAGATGCCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, Laboratory-animal Science, Behavior, Physiology