Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2829 
Type of strain Targeted mutant. 
Strain name C57BL/6-Mpsttm3  
Internal Code C57BL/6J-Mercaptopyruvate sulfurtranferase (targeted mutation 3) 
Submitter ISHII ISAO 
Submitter affiliation or code Showa Pharmaceutical University 
Stock Type  
Material Transfer Conditions Other conditions. 
Collaboration with Prof. Isao Ishii at Showa Pharmaceutical University. Concession to the third person is prohibited. 
Production method In-house breading.
 
Origin
(In-house)
Organization Showa Pharmaceutical University 
Organization code  
Developer Isao Ishii 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Mpst 
Gene name Mercaptopyruvate sulfurtransferase 
Allele symbol Mpstem3  
Allele name Mercaptopyruvate sulfurtransferase, endonuclease-mediated mutation 3, 
MGI MGI:2179733 
Chromosome 15 (E2|15 , 37.47) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Mpst-3  GCATATAAGGCCAGCACACG 
Mpst-7  AGCTGGGCTACATCTTAGAGA 
 

 Reference information
 reference information 1
  Author
Akahoshi, N., Minakawa, T., Miyashita, M., Sugiyama, U., Saito, C., Takemoto, R., Honda, A., Kamichatani, W., Kamata, S., Anan, Y., Ishii, I. 
Title Increased Urinary 3-Mercaptolactate Excretion and Enhanced Passive Systemic Anaphylaxis in Mice Lacking Mercaptopyruvate Sulfurtransferase, a Model of Mercaptolactate-Cysteine Disulfiduria. 
Journal Int J Mol Sci 
Volume 21 
Page 818; doi:10.3390/ijms21030818 
Year 2020 Jan 27 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Behavior