Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2339 
Type of strain Targeted mutant. 
Strain name DBA/2-Mcm3aptm1Imku 
Internal Code ganp-KO (DBA/2) 
Submitter Kuwahara Kazuhiko 
Submitter affiliation or code Aichi Cancer Center Research Institute 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Aichi Cancer Center Research Institute 
Organization code  
Developer Kazuhiko Kuwahara 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Mcm3ap 
Gene name minichromosome maintenance complex component 3 associated protein 
Allele symbol Mcm3aptm1Imku 
Allele name minichromosome maintenance complex component 3 associated protein; targeted mutation 1, Nobuo Sakaguchi 
MGI MGI:1930089 
Chromosome 10 (38.88) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Neo 5'-int  GCAGCTGTGCTCGACGTTGT 
Neo 3'-int  GGCGATACCGTAAAGCACGA 
 

 Reference information
 reference information 1
  Author
Mikoto Yoshida, Kazuhiko Kuwahara, Tatsuya Shimasaki, Naomi Nakagata, Masao Matsuoka, and Nobuo Sakaguchi 
Title GANP suppresses DNA recombination measured by direct-repeat beta-galactosidase gene-construct but not the immunoglobulin-gene-type recombination in mammalian cells. 
Journal Genes to Cells 
Volume 12 
Page 1205-1213 
Year 2007 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
cancer, Development