Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2377 
Type of strain Targeted mutant. 
Strain name C57BL/6-Dnm1tm1 
Internal Code Dnm1flox 
Submitter Yamamura Ken-ichi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Insstitute of Resource Development and Analysis 
Organization code  
Developer Ken-ichi Yamamura 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Dnm1 
Gene name dynamin 1 
Allele symbol Dnm1tm1 
Allele name dynamin 1, targeted mutation 1, 
MGI MGI:107384 
Chromosome 2 (22.09) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Dnm1_intron1_F2  GGGCCTGCAGGGATGCATTTGCCTGGTACCTAGAAC 
Dnm1_intron1_R2  GGGGGGAATTCCTATACCCAACATTGGCTCCTGCTG 
Dnm1_intron4_F2  GGGGGATCCGCGCAGCAGGGGTCTAGTTTTAG 
Dnm1_intron4_R2  GGGGGGAATTCCCCAGCCGGGTAAAAATGTTTCTTTGG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Immunology, Genetics