|
CARD ID
 |
2973 |
Type of strain |
Targeted mutant. |
Strain name |
C57BL/6J-Kng1em1Osb |
Internal Code |
Kng1del/del |
Submitter |
Horiguchi Yasuhiko |
Submitter affiliation or code |
Department of Molecular Bacteriology, Research Institute for Microbial Diseases, Osaka University |
Stock Type |
|
Material Transfer Conditions |
It is necessary to consent to the submitter. Person in Charge
Yukihiro Hiramatsu
Department of Molecular Bacteriology, Research Institute for Microbial Diseases, Osaka University
3-1, Yamada-oka, Suita, Osaka 565-0871, Japan
TEL: [+81]-6-66879-8285
FAX: [+81]-6-6879-8283
E-mail: yhiramatsu@biken.osaka-u.ac.jp |
Production method |
In-house breading. |
Origin (In-house) |
Organization |
|
Organization code |
|
Developer |
|
Origin (From other organizations) |
Organization |
|
Organization code |
|
Developer |
|
Year introduced |
|
Introduced Generation |
|
Remarks |
The mouse was generated by CRISPR/Cas9 system
crRNA sequence
GACCTCAGGAATCTAAATAG
ACAGAGGCACGGGTGCCACA |