Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2678 
Type of strain Targeted mutant. 
Strain name C57BL/6-Ehbp1tm1 
Internal Code EHBP1 KO 
Submitter - - 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Osaka Univ.Grad Sch Med, Dept cell Biol 
Organization code  
Developer Akihiro Harada 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ehbp1 
Gene name EH domain binding protein 1 
Allele symbol Ehbp1tm1 
Allele name EH domain binding protein 1, targeted mutation 1, 
MGI MGI:2667252 
Chromosome 11 (14.10) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer EHBP1-F  CCTGTGAGACAGGGAGAAGACTTATGG 
EHBP1-R  GTGTTCTCAGTTGTAGTCCTCTGAGACG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development, Unknown