Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
479 
Type of strain Targeted mutant. 
Strain name B6;129-Six1tm1(Sall1neo-)Imeg 
Internal Code Six1 KO 
Submitter Nishinakamura Ryuichi 
Submitter affiliation or code Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method
 
Origin
(In-house)
Organization IMEG, Division of Integrative Cell Biology 
Organization code Imeg 
Developer Ryuichi Nishinakamura 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Six1 
Gene name sine oculis-related homeobox 1 homolog (Drosophila) 
Allele symbol  
Allele name  
MGI MGI:102780 
Chromosome 12 (31.0cM) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Six1 Sall1(neo-) mixture of 10μM each  CACCTCCAGTTTGGTGGACTTGG, CAATGCCCTGGCTCACAAATACC, and TTGGAGAGGAGGGAGAGGATGC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development, Anatomy