Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2226 
Type of strain Targeted mutant. 
Strain name B6;129-Prkd1tm1 Prkd2tm1 
Internal Code B6;129-Prkd1 flox, Prkd2 flox 
Submitter - - 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization I.M.C.R., Gunma Univ, 
Organization code  
Developer Akihiro Harada 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Prkd1 
Gene name Protein Kinase D1 
Allele symbol Prkd1tm1 
Allele name Protein Kinase D1, targeted mutation 1 
MGI MGI:99879 
Chromosome 12 (21.78) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Gene information 2
  Gene symbol
Prkd2 
Gene name Protein kinase D2 
Allele symbol Prkd2tm1 
Allele name Protein kinase D2, targeted mutation 1 
MGI MGI:2141917 
Chromosome 7 (9.15) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Geo F  CATCATCACACCCATGCCCTCAAGT 
WT R  CCCAGTTACTCCAAAGTGATTCAAT 
 
 Primer 2
  PCR Primer intron1 F  TCTATTTAGCCCAGCCCCCTCCCACT 
intron1 R  TGGCCCAGCATTGGGGCAGAATGAA 
 

 Reference information
 reference information 1
  Author
Nur Atik, Masataka Kunii, Erda Avriyanti, Naomi Furumoto, Keiko Inami, Shin-ichiro Yoshimura, Reiko Harada, and Akihiro Harada 
Title The Role of PKD in Cell Polarity, Biosynthetic Pathways, and Organelle/F-actin Distribution.  
Journal Cell Structure and Function 
Volume 39 
Page 61-77 
Year 2014 
PMID  
 
 reference information 2
  Author
Avriyanti E, Atik N, Kunii M, Furumoto N, Iwano T, Yoshimura SI, Harada R, Harada A. 
Title Functional redundancy of protein kinase D1 and protein kinase D2 in neuronal polarity. 
Journal Neuroscience Research 
Volume in press 
Page  
Year 2015 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Hematology, Cell biology, Anatomy