Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2185 
Type of strain Targeted mutant. 
Strain name B6;129-Prkd2tm1Aha 
Internal Code B6;129-Prkd2 tm1 
Submitter - - 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization I.M.C.R., Gunma Univ, 
Organization code  
Developer Akihiro Harada 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Prkd2 
Gene name Protein Kinase D2 
Allele symbol Prkd2tm1Aha 
Allele name Protein Kinase D2, targeted mutation 1, Akihiro Harada 
MGI MGI:2141917 
Chromosome 7 (9.15) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer intron1 Forward  TCTATTTAGCCCAGCCCCCTCCCACT 
intron1 Reverse  TGGCCCAGCATTGGGGCAGAATGAA 
 
 Primer 2
  PCR Primer intron1 Forward  TCTATTTAGCCCAGCCCCCTCCCACT 
Geo R  CCGTACAGTTCCACAAAGGCATCCT 
 

 Reference information
 reference information 1
  Author
Nur Atik, Masataka Kunii, Erda Avriyanti, Naomi Furumoto, Keiko Inami, Shin-ichiro Yoshimura, Reiko Harada, and Akihiro Harada 
Title The Role of PKD in Cell Polarity, Biosynthetic Pathways, and Organelle/F-actin Distribution.  
Journal Cell Structure and Function 
Volume 39 
Page 61-77 
Year 2014 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Immunology, Cell biology, Anatomy