Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Disease,Applicable field 
 Strain information
Type of strain Targeted mutant. 
Strain name B6.129-Atp1a2tm2Kwk 
Internal Code BL6N 
Submitter affiliation or code jichi medical university 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method In-house breading.
Organization Jichi Medical University 
Organization code  
Developer Kiyoshi Kawakami 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name ATPase, Na+/K+ transporting, alpha 2 polypeptide  
Allele symbol Atp1a2tm2Kwk 
Allele name ATPase, Na+/K+ transporting, alpha 2 polypeptide; targeted mutation 2, Kiyoshi Kawakami 
Chromosome 1 (79.6) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
 Primer 1
9537-NeoR3  gcctgcttgccgaatatcatggtggaaaat 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Neurobiology, Dermatology, Anatomy, Physiology