Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1428 
Type of strain Targeted mutant. 
Strain name B6.129-Atp1a3tm2Kwk 
Internal Code B6;129-Atp1a3tm2Kwk 
Submitter KAWAKAMI KIYOSHI 
Submitter affiliation or code jichi medical university 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Jichi Medical University 
Organization code  
Developer Kiyoshi Kawakami 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Atp1a3 
Gene name ATPase, Na+/K+ transporting, alpha 3 polypeptide 
Allele symbol Atp1a3tm2Kwk 
Allele name ATPase, Na+/K+ transporting, alpha 3 polypeptide; targeted mutation, Kiyoshi Kawakami 
MGI  
Chromosome 7 (13.73) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer StopF2(5447-5476)  CATACTGTTTTTTCTTACTCCACACAGGCA 
ShortArmR1(5949-5921)  GAGAGAAAAAAATGGAGCTGGAACCTGAG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development, Anatomy, Physiology