Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
456 
Type of strain Gene trap. 
Strain name B6;CB-Fbxl3Gt(pU-21)25Imeg 
Internal Code Ayu21-25 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics Kumamoto University 
Organization code Imeg 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Fbxl3 
Gene name F-box and leucine-rich repeat protein 3 
Allele symbol  
Allele name  
MGI MGI:1354702 
Chromosome 14  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0005737 cytoplasm IEA
GO:0005634 nucleus IEA
GO:0019941 modification-dependent protein catabolic process IEA
GO:0005575 cellular_component ND
GO:0003674 molecular_function ND
GO:0008150 biological_process ND
GO:0005515 protein binding IPI
OMIM OMIM ID: 605653
Human Gene Symbol: FBXL3

GO
GO ID GO Term GO Evidence Code
GO:0005737 cytoplasm IEA
GO:0005634 nucleus IEA
GO:0019941 modification-dependent protein catabolic process IEA
GO:0005575 cellular_component ND
GO:0003674 molecular_function ND
GO:0008150 biological_process ND
GO:0005515 protein binding IPI
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 605653
Human Gene Symbol: FBXL3

 
 Related imformation
  EGTC
21-25