Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2988 
Type of strain Targeted mutant. 
Strain name C57BL/6N-Fbxl20tm1 
Internal Code Scrapper-flox mouse 
Submitter Yao Ikuko 
Submitter affiliation or code Kwansei Gakuin University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Kwansei Gakuin Univ. 
Organization code  
Developer Ikuko Yao 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Fbxl20 
Gene name F-box and leucine-rich repeat protein 20 
Allele symbol Fbxl20tm1 
Allele name F-box and leucine-rich repeat protein 20; targeted mutation 1,  
MGI MGI:1919444 
Chromosome 11 (61.69) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Scrapper-loxF1  GACGGTTGACATGGTGACAG 
Scrapper-loxR1  GTTCTCAAATACAGCGGTGG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Neurobiology