Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes 
 Strain information
  CARD ID
2063 
Type of strain Gene trap. 
Strain name B6.Cg-Fblim1Gt(Ayu21-T327*mERT2)2Card 
Internal Code Fblim1-mERT2,1279 
Submitter Masatake ARAKI 
Submitter affiliation or code Gene Technology Center, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization IRDA, Kumamoto University 
Organization code Card 
Developer Masatake Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Fblim1 
Gene name filamin binding LIM protein 1 
Allele symbol  
Allele name  
MGI MGI:1921452 
Chromosome 4  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Cre-1  acatgttcagggatcgccag 
Cre-2  taaccagtgaaacagcattgc