Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1882 
Type of strain Targeted mutant. 
Strain name C57BL/6-Ffar1tm1Gdds 
Internal Code gpr40KOB6 
Submitter Akira Hirasawa 
Submitter affiliation or code Department of Genomic Drug Discovery Science Graduate School of Pharmaceutical Sciences, Kyoto University  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code Gdds 
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ffar1 
Gene name Ffar1, free fatty acid receptor 1 
Allele symbol Ffar1tm1Gdds 
Allele name targeted mutation 1; Gozoh Tsujimoto 
MGI MGI:2684079 
Chromosome 7 (19.25 ) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer 40-S1  TAGGACTGGCTTCTGGTGCT 
40-AS2,3primer-neo(primer3)  CCTCCTGAGTTGTGGTGGAT,GGCTATTCGGCTATGACTGG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Diabetes, Obesity