Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1881 
Type of strain Targeted mutant. 
Strain name B6.129-Ffar3tm1Gdds 
Internal Code gpr41KOB6 
Submitter Kimura Ikuo 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code Gdds 
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ffar3 
Gene name free fatty acid receptor 3 
Allele symbol Ffar3tm1Gdds 
Allele name targeted mutation 1; Gozoh Tsujimoto 
MGI  
Chromosome 7 (19.25 ) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer out41-s  GCAGCAGAGTGCCAGTTGTCC 
out41-as,3primer-neo(primer3)  GCGTGTGAGTGGTCCTTCCATCC,GGCTATTCGGCTATGACTGG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Diabetes, Obesity