Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1235 
Type of strain Gene trap. 
Strain name B6;CB-Fgfr1Gt(pU-21W)145Card 
Internal Code Ayu21-W145 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization IRDA, kumamoto University 
Organization code  
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Fgfr1 
Gene name fibroblast growth factor receptor 1 
Allele symbol  
Allele name  
MGI MGI:95522 
Chromosome 8 (chr8:26,628,000-26,688,000) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0002062 chondrocyte differentiation IGI
GO:0048699 generation of neurons IMP
GO:0060045 positive regulation of cardiac muscle cell proliferation IGI
GO:0048762 mesenchymal cell differentiation IGI
GO:0001657 ureteric bud development IGI
GO:0001701 in utero embryonic development IGI
GO:0030901 midbrain development IMP, IGI
GO:0010468 regulation of gene expression IMP
GO:0030324 lung development IMP, IGI
GO:0007420 brain development IMP
more... (Total Hit Count: 46)
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0002062 chondrocyte differentiation IGI
GO:0048699 generation of neurons IMP
GO:0060045 positive regulation of cardiac muscle cell proliferation IGI
GO:0048762 mesenchymal cell differentiation IGI
GO:0001657 ureteric bud development IGI
GO:0001701 in utero embryonic development IGI
GO:0030901 midbrain development IMP, IGI
GO:0010468 regulation of gene expression IMP
GO:0030324 lung development IMP, IGI
GO:0007420 brain development IMP
more... (Total Hit Count: 46)
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-W145