CARD R-BASE ( Mouse Strain Resource )

Center for Animal Resources and Development Database !

CARD

Home > Strains > Strain detail

Strain Detail

- Strains

- Genes

- Reference

- Disease,Applicable field

Strain information

	CARD ID		2138
	Type of strain		Targeted mutant.
	Strain name		B6;BDF1-Oosp1^{tm1a(KOMP)Osb}/30
	Internal Code		Oosp1 KO
	Submitter		Ikawa Masahito
	Submitter affiliation or code		Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
	Stock Type
	Material Transfer Conditions		It is necessary to consent to the submitter.
	Production method		In-house breading.
	Origin (In-house)	Organization	Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
		Organization code	Osb
		Developer	Masahito Ikawa
	Origin (From other organizations)	Organization
		Organization code
		Developer
		Year introduced
		Introduced Generation
	Remarks

Gene information

Gene information 1

	Gene symbol		Oosp1
	Gene name		oocyte secreted protein 1
	Allele symbol		Oosp1^{tm1a(KOMP)Osb}/30
	Allele name		oocyte secreted protein 1; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University
	MGI		MGI:2149290
	Chromosome		19 (8.48)
	Gene classification		Targeted or trapped gene(knockout etc.)
	Method		Electroporation
	OMIM

Primer 1

	PCR Primer	#5083	actgatggcgagctcagacc
		#5436	taaggatcaggcctacgata

Primer 2

	PCR Primer	#5759	gtgccgaccactggttccatc
		#5760	gcactgttacagcacagcctctc

Reference information

reference information 1

	Author	Ferheen Abbasi, Mayo Kodani, Chihiro Emori, Daiji Kiyozumi, Masashi Mori, Yoshitaka Fujihara, Masahito Ikawa.
	Title	CRISPR/Cas9-Mediated Genome Editing Reveals Oosp Family Genes are Dispensable for Female Fertility in Mice.
	Journal	Cells
	Volume	9(4)
	Page
	Year	2020
	PMID

Disease , Applicable field information

Disease name,
Applicable field

Development