Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2901 
Type of strain Targeted mutant. 
Strain name C57BL/6-Uacatm1 
Internal Code Nucling-KO mouse 
Submitter Ishidoh Kazumi 
Submitter affiliation or code Tokushima Bunri University, Institute for Health Sciences 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Tokushima Bunri University, Institute for Health Sciences 
Organization code  
Developer TAKASHI SAKAI 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Uaca 
Gene name uveal autoantigen with coiled-coil domains and ankyrin repeats 
Allele symbol Uacatm1 
Allele name uveal autoantigen with coiled-coil domains and ankyrin repeats; targeted mutation 1, 
MGI MGI:1919815 
Chromosome 9 (32.93) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer NeoC1  ccggtggatgtggaatgtgtgcgagg 
C3A1  ctccgcgtatctctgtgttgcctccga 
 

 Reference information
 reference information 1
  Author
Sakai T, Liu L, Teng X, Ishimaru N, Mukai-Sakai R, Tran NH, Kim SM, Sano N, Hayashi Y, Kaji R, Fukui K 
Title Inflammatory disease and cancer with a decrease in Kupffer cell numbers in Nucling-knockout mice. 
Journal Int J Cancer. 
Volume 126 
Page 1079-94 
Year 2010 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Digestive Disorders, Metabolism, cancer, Diabetes, Obesity, Immunology