Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2822 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(Fabp-PLIN) 
Internal Code Perilipin Tg(homo),Perilipin 
Submitter Atsumi Tatsuya 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Hokkaido University 
Organization code  
Developer MIKIKO ENDO 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Plin 1 
Gene name Peliripin 1 
Allele symbol  
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer U1-S  5'GGCCCCCATTGGTCACTCCTAC3' 
U1-AS  5'CGCTCTGCACGCCCTTCTCATA3' 
 

 Reference information
 reference information 1
  Author
Masatatsu Yamamoto 
Title Abcb10 role in heme biosynthesis in vivo: Abcb10 knockout in mice causes anemia with protoporphyrin IX and iron accumulation 
Journal Molecular and Cellular Biology  
Volume 34 
Page 1077 
Year 2014 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Diabetes, Obesity