Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2973 
Type of strain Targeted mutant. 
Strain name C57BL/6J-Kng1em1Osb 
Internal Code Kng1del/del 
Submitter Horiguchi Yasuhiko 
Submitter affiliation or code Department of Molecular Bacteriology, Research Institute for Microbial Diseases, Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Person in Charge Yukihiro Hiramatsu Department of Molecular Bacteriology, Research Institute for Microbial Diseases, Osaka University 3-1, Yamada-oka, Suita, Osaka 565-0871, Japan TEL: [+81]-6-66879-8285 FAX: [+81]-6-6879-8283 E-mail: yhiramatsu@biken.osaka-u.ac.jp 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks The mouse was generated by CRISPR/Cas9 system crRNA sequence GACCTCAGGAATCTAAATAG ACAGAGGCACGGGTGCCACA 
 
 Gene information
 Gene information 1
  Gene symbol
Kng1 
Gene name kininogen 1 
Allele symbol Kng1em1Osb 
Allele name kininogen 1; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI  
Chromosome 16 (13.88) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Outer Fw  GCAGAGCCATCCTGAGGAAA 
Outer Rv  ACTCCCCAGCTGCTATCAGA 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Hematology, Neurobiology, infectious, Respiratory System