Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
595 
Type of strain Gene trap. 
Strain name B6;CB-Hsf1Gt(pU-18)54Imeg 
Internal Code Ayu18-54 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics Kumamoto University 
Organization code Imeg 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks p1A 
 
 Gene information
 Gene information 1
  Gene symbol
Hisf1 
Gene name heat shock factor 1 
Allele symbol  
Allele name  
MGI MGI:96238 
Chromosome 15  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0006950 response to stress IEA
OMIM OMIM ID: 140580
Human Gene Symbol: HSF1

GO
GO ID GO Term GO Evidence Code
GO:0006950 response to stress IEA
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 140580
Human Gene Symbol: HSF1

 
 Related imformation
  EGTC
18-54