Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2632 
Type of strain Targeted mutant. 
Strain name C57BL/6-Hcar2em1 
Internal Code Gpr109aKO 
Submitter Kimura Ikuo 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Department of Applied Biological Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology 
Organization code  
Developer Ikuo Kimura 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Hcar2 
Gene name hydroxycarboxylic acid receptor 2  
Allele symbol Hcar2em1 
Allele name hydroxycarboxylic acid receptor 2; endonuclease-mediated mutation 1, 
MGI MGI:1933383 
Chromosome 5 (63.24) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Gpr109a-PCR-F2  AATTTCACACGAACTCTTACTGCTC 
Gpr109a-PCR-R1  GAGAACAATCAAATCTTTTGCATCT 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown