Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2149 
Type of strain Targeted mutant. 
Strain name B6;129-Hhextm1Ngu 
Internal Code B6;129-Hhextm1Ngu 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code  
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Hhex 
Gene name hematopoietically expressed homeobox 
Allele symbol Hhextm1Ngu 
Allele name hematopoietically expressed homeobox; targeted mutation 1, Tamio Noguchi 
MGI MGI:96086 
Chromosome 19 (32.28) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer NCR  AGCAGCCATGGTGCTACAGGGCAAGTCTCTA 
KS  TCGAGGTCGACGGTATCGATAAGCTTGATA 
 
 Primer 2
  PCR Primer UTR  AGAGGTTTCAGGCACCTAGCGAGCGACTGC 
 

 Reference information
 reference information 1
  Author
Keng VW et al 
Title Homeobox gene hex is essential for onset of mouse embryonic liver development and differentiation of the monocyte lineage 
Journal Biochem Biophys Res Commun 
Volume 5;276(3) 
Page 1155-61 
Year 2000 
PMID