Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
1890 
Type of strain Targeted mutant. 
Strain name B6;CB-Hmga1tm1(Hmga1-EGFP-IRES-neo)IN1Imeg 
Internal Code HMGA1-EGFPIN1 
Submitter Nakao Mitsuyoshi 
Submitter affiliation or code Department of Medical Cell Biology Director, Institute of Molecular Embryology and Genetics Kumamoto University 
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University 
Organization code Imeg 
Developer Mitsuyoshi Nakao 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Hmga1 
Gene name high mobility group AT-hook 1 
Allele symbol  
Allele name high mobility group AT-hook 1, targeted mutation 1, Institute of Molecular Embryology and Genetics. 
MGI  
Chromosome 17 (A3.3 , 14.5) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Hmga1-EGFP-A  TCATCCCCCTTTTGCAGAGG 
Hmga1-EGFP-B  CGCTCCTGGACGTAGCCTTC 
 
 Primer 2
  PCR Primer Hmga1-EGFP-C  TACCTGCCCATTCGACCACC 
Hmga1-EGFP-D  ACAGGGACTGAGCCGAATCC 
 

 Reference information
 reference information 1
  Author
Li-Mei Chen, Cindy Wang, Mengqian Chen, Matthew R. Marcello, Julie Chao, Lee Chao and Karl X. Chai 
Title Prostasin attenuates inducible nitric oxide synthase expression in lipopolysaccharide-induced urinary bladder inflammation 
Journal Am J Physiol Renal Physiol 
Volume 291 
Page F567-F577 
Year 2006 
PMID