Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1836 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(Has2) 
Internal Code Has2 cTg (C57BL/6) 
Submitter Itano Naoki 
Submitter affiliation or code Department of Molecular Biosciences,Faculty of Life Sciences,Kyoto Sangyo University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Kyoto Sangyo University 
Organization code  
Developer Naoki Itano 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Has2 
Gene name Hyaluronan Synthase 2 
Allele symbol Tg(Has2) 
Allele name trasgene insertion 
MGI MGI:107821 
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer mHAS2 S-2 primer  GACCTGGTGAGACAGAAGAGTCCC 
mHAS2 R-798 primer  TATATTAAAAGCCATCCAGTATCTCACG 
 

 Reference information
 reference information 1
  Author
Koyama H, et al. 
Title Significance of tumor-associated stroma in promotion of intratumoral lymphangiogenesis : pivotal role of a hyaluronan-rich tumor 
Journal Am. J. Pathol. 
Volume 172 
Page 179-193 
Year 2008 
PMID  
 
 reference information 2
  Author
Koyama H, et al. 
Title Hyperproduction of hyaluronan in neu-induced mammary tumor accelerates angiogenesis through stromal cell recruitment: possible involvement of versican /PG-M. 
Journal Am. J. Pathol. 
Volume 170 
Page 1086-1099 
Year 2007 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
cancer, Development, Others