Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1591 
Type of strain Gene trap. 
Strain name B6;CB-Hmbox1Gt(pU-21T)346Card 
Internal Code Ayu21-T346 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method
 
Origin
(In-house)
Organization IRDA, Kumamoto University 
Organization code  
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Hmbox1 
Gene name homeobox containing 1 
Allele symbol  
Allele name  
MGI MGI:2445066 
Chromosome 14  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2   TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-T346