Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
Type of strain Targeted mutant. 
Strain name C57BL/6N-Vps52tm1.1Card 
Internal Code Vps52VADwt 
Submitter Araki Kimi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method In-house breading.
Organization code  
Developer Kimi Araki 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name VPS52 GARP complex subunit 
Allele symbol Vps52tm1.1Card 
Allele name VPS52 GARP complex subunit, targeted mutation 1.1 
MGI MGI:1330304 
Chromosome 17 (17qB1 , 17.98) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
 Primer 1
  PCR Primer Vps52_genome_F18  cctttgattctgattaagcctgc 
Vps52VAD_R4  tacccctgcaagttctgtca 

 Reference information
 reference information 1
Michihiko Sugimoto, Masayo Kondo, Michiko Hirose, Misao Suzuki, Kazuyuki Mekada, Takaya Abe, Hiroshi Kiyonari, Atsuo Ogura, Nobuo Takagi, Karen Artzt, and Kuniya Abe 
Title Molecular Identification of tw5: Vps52 Promotes Pluripotential Cell Differentiation through Cell–Cell Interactions 
Journal Cell Reports 
Page 1363-1374 
Year 2012 
 Disease , Applicable field information
  Disease name,
Applicable field
Hematology, Laboratory-animal Science, Development