Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2989 
Type of strain Targeted mutant. 
Strain name C57BL/6J-Six2em1 
Internal Code Six2 (f102) 
Submitter Takahashi Masanori 
Submitter affiliation or code Center for Molecular Medicine, Jichi Medical University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Jichi Medical University 
Organization code  
Developer Masanori Takahashi 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Six2 
Gene name sine oculis-related homeobox 2 
Allele symbol Six2em1  
Allele name  
MGI MGI:102778 
Chromosome 17 (55.72) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Six2-F primer (25mer)  TCCTCCTCCTCTGCTCTTTGGGCGT  
Six2-Mut-R primer (25mer)  CTCCCAGTCTTTCGGCAGATCCCAG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Dentistry, Urology, Development