CARD R-BASE ( Mouse Strain Resource )

Center for Animal Resources and Development Database !

CARD

Home > Strains > Strain detail

Strain Detail

- Strains

- Genes

- Reference

- Disease,Applicable field

Strain information

	CARD ID		2204
	Type of strain		Targeted mutant. Transgenic.
	Strain name		B6;129-Dedd^tm1TimyTg(Cdh5-Dedd)6Timy
	Internal Code		DEDD KO/ DEDD TG
	Submitter		Miyazaki Toru
	Submitter affiliation or code		Lab of Molecular Biomedicine for Pathogenesis, Center for Disease Biology and Integrative Medicine (CDBIM), The University of Tokyo
	Stock Type
	Material Transfer Conditions		It is necessary to consent to the submitter.
	Production method		In-house breading.
	Origin (In-house)	Organization
		Organization code
		Developer
	Origin (From other organizations)	Organization
		Organization code
		Developer
		Year introduced
		Introduced Generation
	Remarks

Gene information

Gene information 1

	Gene symbol		Dedd
	Gene name		Death effector domain-containing (with C-terminal HA-tag)
	Allele symbol		Tg(Cdh5-Dedd)
	Allele name		transgene insertion
	MGI
	Chromosome
	Gene classification		Gene to express(transgenic)
	Method		MicroInjection
	OMIM

Gene information 2

	Gene symbol		Dedd
	Gene name		death effector domain-containing
	Allele symbol		Dedd^tm1Timy
	Allele name		death effector domain-containing, targeted mutation 1, Toru Miyazaki
	MGI		MGI:1333874
	Chromosome		1 (79.34)
	Gene classification		Targeted or trapped gene(knockout etc.)
	Method		Electroporation
	OMIM

Primer 1

	PCR Primer	beta-globin 5	tgctggttattgtgctgtctcatc
		Dedd215-191	tccagtgccaataagaagtcacgtc

Primer 2

	PCR Primer	TM-1	cagccagatttacatagtgaaatc
		NY-5	ccgctatcaggacatagcgttggc

Primer 3

	PCR Primer	DEDD Exon2	gcactctatttctgagcctctagc
		DEDD Intron2-3	atctttcttctcccaaaggatctc

Reference information

reference information 1

	Author	Mori M, Kitazume M, Ose R, Kurokawa J, Koga K, Osuga Y, Arai S, Miyazaki T
	Title	Death effector domain-containing protein (DEDD) is required for uterine decidualization during early pregnancy in mice.
	Journal	J Clin Invest
	Volume	121
	Page	318-27
	Year	2011
	PMID

Disease , Applicable field information

Disease name,
Applicable field

Reproduction