Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1269 
Type of strain Gene trap. 
Strain name B6;CB-0610010K06RikGt(pU-21W)144Card 
Internal Code Ayu21-W144 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization IRDA, Kumamoto University 
Organization code  
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
0610010K06Rik 
Gene name RIKEN cDNA 0610010K06 gene 
Allele symbol  
Allele name  
MGI MGI:1918928 
Chromosome 1  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0016020 membrane IEA, IEA
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0016020 membrane IEA, IEA
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-W144