Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
762 
Type of strain Targeted mutant. 
Strain name B6;CB-B4galt6tm1 
Internal Code none 
Submitter Koichi Furukawa 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Nagoya Univ. Sch. of Med. 
Organization code  
Developer Koichi Furukawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
B4galt6 
Gene name UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 
Allele symbol B4galt6tm1 
Allele name targeted mutation 1 
MGI MGI:1928380 
Chromosome 18 (q12) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0005794 Golgi apparatus IEA
GO:0000287 magnesium ion binding IEA
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0030145 manganese ion binding IEA
GO:0016740 transferase activity IEA
GO:0005509 calcium ion binding IEA
GO:0016757 transferase activity, transferring glycosyl groups IEA
GO:0008378 galactosyltransferase activity ISO
GO:0046872 metal ion binding IEA
more... (Total Hit Count: 12)
OMIM OMIM ID: 604017
Human Gene Symbol: B4GALT6

GO
GO ID GO Term GO Evidence Code
GO:0005794 Golgi apparatus IEA
GO:0000287 magnesium ion binding IEA
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0030145 manganese ion binding IEA
GO:0016740 transferase activity IEA
GO:0005509 calcium ion binding IEA
GO:0016757 transferase activity, transferring glycosyl groups IEA
GO:0008378 galactosyltransferase activity ISO
GO:0046872 metal ion binding IEA
more... (Total Hit Count: 12)
 
 Primer 1
  PCR Primer Se1  GCCTGCTTGCCGAATATCATGGTGGAAAAT 
T6K031  CCCTCTGCAAGAACAAGAGTTTCACCTCA 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown 
  OMIM OMIM ID: 604017
Human Gene Symbol: B4GALT6