Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
609 
Type of strain Gene trap. 
Strain name B6;CB-BptfGt(pU-18)44Imeg 
Internal Code Ayu18-44 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics Kumamoto University 
Organization code Imeg 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Bptf 
Gene name bromodomain PHD finger transcription factor 
Allele symbol  
Allele name  
MGI MGI:2444008 
Chromosome 11  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0046872 metal ion binding IEA
GO:0008270 zinc ion binding IEA
GO:0043565 sequence-specific DNA binding ISS
GO:0007420 brain development ISS
GO:0006338 chromatin remodeling ISS
GO:0008134 transcription factor binding ISO
GO:0000122 negative regulation of transcription from RNA polymerase II promoter ISO
GO:0005634 nucleus ISS
GO:0045449 regulation of transcription ISS
GO:0008094 DNA-dependent ATPase activity ISS
more... (Total Hit Count: 11)
OMIM OMIM ID: 601819
Human Gene Symbol: BPTF

GO
GO ID GO Term GO Evidence Code
GO:0046872 metal ion binding IEA
GO:0008270 zinc ion binding IEA
GO:0043565 sequence-specific DNA binding ISS
GO:0007420 brain development ISS
GO:0006338 chromatin remodeling ISS
GO:0008134 transcription factor binding ISO
GO:0000122 negative regulation of transcription from RNA polymerase II promoter ISO
GO:0005634 nucleus ISS
GO:0045449 regulation of transcription ISS
GO:0008094 DNA-dependent ATPase activity ISS
more... (Total Hit Count: 11)
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 601819
Human Gene Symbol: BPTF

 
 Related imformation
  EGTC
18-44