Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
459 
Type of strain Gene trap. 
Strain name B6;CB-Bmpr1aGt(pU-21)17Imeg 
Internal Code Ayu21-17 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics Kumamoto University 
Organization code Imeg 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Bmpr1a 
Gene name bone morphogenetic protein receptor, type 1A 
Allele symbol  
Allele name  
MGI MGI:1338938 
Chromosome 14  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0003007 heart morphogenesis IMP
GO:0048589 developmental growth IMP
GO:0060021 palate development IMP
GO:0002053 positive regulation of mesenchymal cell proliferation IMP
GO:0048598 embryonic morphogenesis IMP
GO:0021983 pituitary gland development IMP
GO:0046872 metal ion binding IEA
GO:0048568 embryonic organ development IMP
GO:0001701 in utero embryonic development IMP
GO:0051216 cartilage development IMP
more... (Total Hit Count: 44)
OMIM OMIM ID: 601299
Human Gene Symbol: BMPR1A

GO
GO ID GO Term GO Evidence Code
GO:0003007 heart morphogenesis IMP
GO:0048589 developmental growth IMP
GO:0060021 palate development IMP
GO:0002053 positive regulation of mesenchymal cell proliferation IMP
GO:0048598 embryonic morphogenesis IMP
GO:0021983 pituitary gland development IMP
GO:0046872 metal ion binding IEA
GO:0048568 embryonic organ development IMP
GO:0001701 in utero embryonic development IMP
GO:0051216 cartilage development IMP
more... (Total Hit Count: 44)
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
  OMIM OMIM ID: 601299
Human Gene Symbol: BMPR1A
Allelic Variant Name :
JUVENILE POLYPOSIS OF INFANCY
JUVENILE POLYPOSIS SYNDROME
POLYPOSIS SYNDROME, HEREDITARY MIXED, 2

 
 Related imformation
  EGTC
21-17