Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2783 
Type of strain Targeted mutant. 
Strain name C57BL/6-BC049762em1 
Internal Code BC049762 
Submitter Ishiguro Kei-ichiro 
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
BC049762 
Gene name cDNA sequence BC049762 
Allele symbol BC049762em1 
Allele name cDNA sequence BC049762; endonuclease-mediated mutation 1, 
MGI MGI:3039622 
Chromosome 11 (31.02) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer BC049762-1F  CTGTTCCCGGAATCTGTTCACAGCCG 
BC049762-1R  TCTTTCCTTATGAACCCCACTGAAG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Reproduction, Cell biology