Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2679 
Type of strain Targeted mutant. 
Strain name C57BL/6-B230118H07Riktm1 
Internal Code C11orf74 KO 7bp del 
Submitter - - 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Dept cell Biol,Grad Sch of Med, Osaka Univ. 
Organization code  
Developer Akihiro Harada 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
B230118H07Rik 
Gene name RIKEN cDNA B230118H07 gene 
Allele symbol B230118H07Riktm1 
Allele name RIKEN cDNA B230118H07 gene, targeted mutation 1, 
MGI MGI:1915420 
Chromosome 2 (53.83) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer mC11ORF74-genome-FW  GGGTGCCCTTTGAGATTTTCC 
mC11ORF74-genome-RV  AAAGGCATAGGTGTCCATACC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown