Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2201 
Type of strain Transgenic. 
Strain name C57BL/6Slc-Tg(NSE-betaCTFV717F,NSE-PS1P267S) 
Internal Code C105F/PS1P267S 
Submitter Akira Kakizuka 
Submitter affiliation or code Graduate School of Biostudies, Kyoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Graduate School of Biostudies, Kyoto University 
Organization code  
Developer Akira Kakizuka 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
PS1(P267S) 
Gene name HA-tagged full-length mutant presenilin 1 (P267S) 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Gene information 2
  Gene symbol
betaCTF(V717F) 
Gene name FLAG-tagged C-terminal portion of human betaCTF with Indiana mutation (V717F) 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer FLAG-C105F  GACTACAAGGACGACGATGACAAGGG 
C105F-genotyping primer(as)  TGCATCTGCTCAAAGAACTTGTAGG 
 
 Primer 2
  PCR Primer NSE-seq(s)  CAAGGCTGGTCCTCATCCAT 
NSE-seq(as)  GTCCTCGTCCTCATAGTACT 
 
 Primer 3
  PCR Primer hPS1-LC(s)  TTCGACTCCAGCAGGCATATCTC 
hPS1-LC(as)  AAGTGGACCTTTCGGACACAA 
 

 Reference information
 reference information 1
  Author
Norio Sasaoka, Megumi Sakamoto, Shoko Kanemori, Michiru Kan, Chihiro Tsukano, Yoshiji Takemoto, Akira kakizuka 
Title Long-term Oral Administration of Hop Flower Extracts Mitigates Alzheimer Phenotypes in Mice 
Journal PLOS ONE 
Volume
Page  
Year 2014 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology