Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2200 
Type of strain Transgenic. 
Strain name C57BL/6Slc-Tg(NSE-betaCTFV717F) 
Internal Code C105F 
Submitter Akira Kakizuka 
Submitter affiliation or code Graduate School of Biostudies, Kyoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Graduate School of Biostudies, Kyoto University 
Organization code  
Developer Akira Kakizuka 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
betaCTF(V717F) 
Gene name FLAG-tagged C-terminal portion of human betaCTF with Indiana mutation (V717F) 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer FLAG-C105F  GACTACAAGGACGACGATGACAAGGG 
C105F-genotyping primer(as)  TGCATCTGCTCAAAGAACTTGTAGG 
 
 Primer 2
  PCR Primer NSE-seq(s)  CAAGGCTGGTCCTCATCCAT 
NSE-seq(as)  GTCCTCGTCCTCATAGTACT 
 

 Reference information
 reference information 1
  Author
Norio Sasaoka, Megumi Sakamoto, Shoko Kanemori, Michiru Kan, Chihiro Tsukano, Yoshiji Takemoto, Akira kakizuka 
Title Long-term Oral Administration of Hop Flower Extracts Mitigates Alzheimer Phenotypes in Mice 
Journal PLOS ONE 
Volume
Page  
Year 2014 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology