Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1822 
Type of strain Targeted mutant. 
Strain name B6.Cg-Bcl9ltm1Taki 
Internal Code B9L KO 
Submitter Akiyama Tetsu 
Submitter affiliation or code Laboratory of Molecular and Genetic Information Institute for Molecular and Cellular Biosciences The University of Tokyo 
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular and Cellular Biosciences, The University of Tokyo 
Organization code Taki 
Developer Tetsu Akiyama 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Bcl9l 
Gene name B-cell CLL/lymphoma 9-like 
Allele symbol Bcl9ltm1 
Allele name B-cell CLL/lymphoma 9-like; targeted mutation 1, Tetsu Akiyama 
MGI MGI:1933114 
Chromosome 9 (24.84) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Bcl9l forward  CCAGCACCAGAATGTGAACCAAGGACCCAC 
Bcl9l reverse  GCACCATGAGGCACAGCATCAATGGGCACTC 
 
 Primer 2
  PCR Primer Neo forward  TCGTGCTTTACGGTATCGCCGCTCCCGATT 
Bcl9l reverse  GCACCATGAGGCACAGCATCAATGGGCACTC 
 
 Primer 3
  PCR Primer Bcl9ltypeFW2  TGTCCCCTCGGGGCCACTGCC  
LacZtypeRV  AGGGCGATCGGTGCGGGCCT 
 

 Reference information
 reference information 1
  Author
Shungo Adachi, Takafumi Jigami, Toshio Yasui, Tetsuhiro Nakano, Susumu Ohwada, Yoshihiro Omori, Sumio Sugano, Bisei Ohkawara, Hiroshi Shibuya, Tsutomu Nakamura, Tetsu Akiyama 
Title Role of a BCL9-Related Beta-Catenin-Binding Protein, B9L, in Tumorigenesis Induced by Aberrant Activation of Wnt Signaling 
Journal Cancer Research 
Volume 64 
Page 8496-8501 
Year 2004 
PMID  
 
 reference information 2
  Author
Ken Matsuura, Takafumi Jigami, Kenzui Taniue, Yasuyuki Morishita, Shungo Adachi, Takao Senda, Aya Nonaka, Hiroyuki Aburatani, Tsutomu Nakamura and Tetsu Akiyama 
Title Identification of a link between Wnt/beta-catenin signaling and the cell fusion pathway 
Journal Nature Communications 
Volume
Page 548 
Year 2011 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Cell biology, Development