Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1771 
Type of strain Targeted mutant. 
Strain name B6;CB-Bnc2tm3(Bnc2)12Card 
Internal Code B6;CB-Bnc2tm3(Bnc2)12Card 
Submitter Masatake ARAKI 
Submitter affiliation or code Gene Technology Center, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code Card 
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Bnc2 
Gene name Basonuclin 2 
Allele symbol Bnc2tm3(Bnc2)12Card 
Allele name Basonuclin 2; targeted mutation 3, Center for Animal Resources & Development 
MGI  
Chromosome 4 (39.76) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer SA-11  CCCGAAAACCAAAGAAGAAG 
Bnc2-1  GGTTAGTGTCAGCGTTTTGCC 
 

 Reference information
 reference information 1
  Author
Tashiro, F., Kanai-Azuma, M., Miyazaki, S., Kato, M., Tanaka, T., Toyoda , S., Yamato, E., Kawakami, H., Miyazaki, T. and Miyazaki, J. 
Title Maternal-effect gene Ces5/Ooep/Moep19/Floped is essential for oocyte cytoplasmic lattice formation and embryonic development at the maternal-zygotic stage transition 
Journal Genes Cells  
Volume 15 
Page 813-828 
Year 2010 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development