Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
3075 
Type of strain Targeted mutant. 
Strain name C57BL/6NJcl-Pon1em1 
Internal Code Pon1 Knockout Hetero 
Submitter Miura Kyoko 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced November 2018  
Introduced 
Generation
F0 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Pon1 
Gene name Paraoxonase1 
Allele symbol Pon1em1 
Allele name Paraoxonase1; endonuclease-mediated mutation 1, 
MGI MGI:103295 
Chromosome 6 (1.99 cM) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Pon1_KO_primer_F  TGGCTAAATTGGAGCTGTGG 
Pon1_KO_primer_R  AGTGTTCACCCAGAACAAGGAG 
 
 Primer 2
  PCR Primer Pon1_Wild_primer_F  AGAGCTTTGCTAATGCCTCCAGT 
Pon1_Wild_primer_R  ATGCCCTGTGTTTGGAATGCTCT 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Pharmacology, Aging