Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2362 
Type of strain Targeted mutant. 
Strain name C3H/HeJ-Cbstm1Unc 
Internal Code C3H/HeJ-Cbs-knockout 
Submitter ISHII ISAO 
Submitter affiliation or code Showa Pharmaceutical University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Showa Pharmaceutical University 
Organization code  
Developer Isao Ishii 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Cbs 
Gene name cystathionine beta-synthase 
Allele symbol Cbstm1Unc 
Allele name cystathionine beta-synthase, targeted mutation 1 
MGI MGI:88285 
Chromosome 17 (16.93) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer CBS-KO-1 (Common)  CGGATGACCTGCATTCATCT 
CBS-KO-2 (WT specific)  GAAGTGGAGCTATCAGAGCA 
CBS-KO-3 (KO specific)  GAGGTCGACGGTATCGATA 
 

 Reference information
 reference information 1
  Author
Akahoshi, N., Kobayashi, C., Ishizaki, Y., Izumi, T., Himi, T., Suematsu, M., Ishii, I. 
Title Genetic background conversion ameliorates semi-lethality and permits behavioral analyses in cystathionine beta-synthase-deficient mice, an animal model for hyperhomocysteinemia. 
Journal Hum Mol Genet 
Volume 17 
Page 1994-2005 
Year 2008 
PMID  
 
 reference information 2
  Author
Morikawa, T., Kajimura, M., Nakamura, T., Hishiki, T., Nakanishi, T., Yukutake, Y., Nagahata, Y., Ishikawa, M., Hattori, K., Takenouchi, T., Takahashi, T., Ishii, I., Matsubara, K., Kabe, Y., Uchiyama, S., Nagata, E., Gadalla, M.M., Snyder, S.H., Suematsu, M. 
Title Hypoxic regulation of the cerebral microcirculation is mediated by a carbon monoxide-sensitive hydrogen sulfide pathway. 
Journal Proc Natl Acad Sci USA 
Volume 109 
Page 1293-1298 
Year 2012 
PMID  
 
 reference information 3
  Author
Nakano, S., Ishii, I., Shinmura, K., Tamaki, K., Hishiki, T., Akahoshi, N., Ida, T., Nakanishi, T., Kamata, S., Kumagai, Y., Akaike, T., Fukuda, K., Sano, M., Suematsu, M. 
Title Hyperhomocysteinemia abrogates fasting-induced cardioprotection against ischemia/reperfusion by limiting bioavailability of hydrogen sulfide anions. 
Journal J Mol Med (Berl) 
Volume 93 
Page 879-889 
Year 2015 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Osteosis, Hematology, Digestive Disorders, Metabolism, Neurobiology, Dermatology, Development, Pharmacology, Behavior, Physiology