Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1790 
Type of strain Targeted mutant. 
Strain name Alk2-flox 
Internal Code Alk2-flox mouse 
Submitter Tamamaki Nobuaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
You need MTA with Michigan Univ. 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization University of Michigan 
Organization code  
Developer Vesa Kaartinen 
Year introduced April 2011  
Introduced 
Generation
 
Remarks Need MTA with University of Michigan 
 
 Gene information
 Gene information 1
  Gene symbol
Acvr1 (synonymous to Alk2) 
Gene name Activin receptor type 1 
Allele symbol Alk2tm1 
Allele name Activin receptor type 1; targeted mutation 1 
MGI  
Chromosome 2 (33.05) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer Alk2I7F (Alk2-Intron7-Forward)  CCCCCATTGAAGGTTTAGAGAGAC 
Alk2I7R2 (Alk2-Intron7-Reverse2)  CTAAGAGCCATGACAGAGGTTG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Osteosis, Hematology, Digestive Disorders, Neurobiology, Urology, Development