Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2193 
Type of strain Targeted mutant. 
Strain name B6;129-Clec4etm1(GFP-IRES-DTR)Sym 
Internal Code Mincle-GID 
Submitter Yamasaki Sho 
Submitter affiliation or code Department of Molecular Immunology, Research Institute for Microbial Diseases, Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Clec4e 
Gene name C-type lectin domain family 4, membere 
Allele symbol Clec4etm1(GFP-IRES-DTR)Sym 
Allele name C-type lectin domain family 4, membere, Targeted mutation 1,  
MGI MGI:1861232 
Chromosome 6 (58.35) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer MGID-F  TTCAGAATGTGGTACTGAGGCAC 
MGID-R  AGAAGGTAGAAACAGTCAGCAGG  
 
 Primer 2
  PCR Primer MGID-F  TTCAGAATGTGGTACTGAGGCAC 
ATGGGCACCACCCCGGTGAACAG  EGFP-R 
 

 Reference information
 reference information 1
  Author
Heckel JL, Sandgren EP, Degan JL, Palmiter RD, Brinster RL 
Title Neonatal bleeding in transgenic mice expressing urokinase-type plasminogen activtor. 
Journal Cell 
Volume 62 
Page 447-456 
Year 1990 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
infectious, Immunology