Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1683 
Type of strain Targeted mutant. 
Strain name B6;129-Cxcl14tm1 
Internal Code Cxcl14-KO 
Submitter Masanobu Oshima 
Submitter affiliation or code Division of Genetics, Cancer Research Institute, Kanazawa University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Cancer Res. Institute, Kanazawa Univ 
Organization code  
Developer Hiroko Oshima 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Cxcl14 
Gene name chemokine (C-X-C motif) ligand 14 
Allele symbol Cxcl14tm1 
Allele name chemokine (C-X-C motif) ligand 14; targeted mutation 1, Hiroko Oshima (Kanazawa University) 
MGI  
Chromosome 13 (30.06) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM OMIM ID: 0
Human Gene Symbol:

 
 Primer 1
  PCR Primer EGFP-F  ccgacaaccactacctgagca 
PGKR  ctaaagcgcatgctccagact 
 

 Disease , Applicable field information
  Disease name,
Applicable field
cancer, Immunology 
  OMIM OMIM ID: 0
Human Gene Symbol: